View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19307_low_24 (Length: 297)
Name: NF19307_low_24
Description: NF19307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19307_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 10 - 282
Target Start/End: Original strand, 6627078 - 6627356
Alignment:
| Q |
10 |
aacaatatcctcaaaatgaattacctgcgcattttaaatccaacgggaagagaaccaacaccaaca------tcagattccgtgactctaccagaagctt |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6627078 |
aacaaaatcctcaaaatgaattacctgcgcattttaaatccaacgggaagagaaccaacaccaacattaacatcagattccgtgactctaccagaagctt |
6627177 |
T |
 |
| Q |
104 |
ctctcggcgacggggatggcccagaagcttctttcggcaatggcgacggcaaccgacaatcaacatctctttgccttaacaacccaccaggtgactccgg |
203 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6627178 |
ctctcggcgacagggatggtccagaagcttctttcggcaatggcgacggcaaccgacaatcagcatctctttgccttaacaacccaccaggtgactccgg |
6627277 |
T |
 |
| Q |
204 |
caacggcaacggctgaggtgcaacggaggaagaagtattagaccgaatataaccccgtgcactcggagaccgttgaatc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6627278 |
caacggcaacggctgaggtgcaacggaggaagaagtattagaccgaatataaccccgtgcactcggagaccgttgaatc |
6627356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University