View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19307_low_28 (Length: 256)

Name: NF19307_low_28
Description: NF19307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19307_low_28
NF19307_low_28
[»] chr1 (1 HSPs)
chr1 (187-241)||(7742611-7742662)
[»] chr3 (2 HSPs)
chr3 (191-239)||(40864400-40864448)
chr3 (48-100)||(40863619-40863671)


Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 7742611 - 7742662
Alignment:
187 catgcatgcaggcttcattatcggtcctgatgtgcaagacgaagatgataatact 241  Q
    |||||||||||||||||||||||||   |||||||||||||||||||||||||||    
7742611 catgcatgcaggcttcattatcggt---gatgtgcaagacgaagatgataatact 7742662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 191 - 239
Target Start/End: Original strand, 40864400 - 40864448
Alignment:
191 catgcaggcttcattatcggtcctgatgtgcaagacgaagatgataata 239  Q
    ||||||||||||||| | || ||||||||||||||||||||||||||||    
40864400 catgcaggcttcattgttgggcctgatgtgcaagacgaagatgataata 40864448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 100
Target Start/End: Original strand, 40863619 - 40863671
Alignment:
48 aaggtttctgctttgaatttctttgatgaagaggctgatgttgattctgatga 100  Q
    |||||||| ||||  ||||||||||| |||||||||| ||||||||| |||||    
40863619 aaggtttccgcttcaaatttctttgacgaagaggctgctgttgattcggatga 40863671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University