View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19307_low_32 (Length: 250)
Name: NF19307_low_32
Description: NF19307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19307_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 3 - 237
Target Start/End: Complemental strand, 26901613 - 26901379
Alignment:
| Q |
3 |
ttgatcaaacgaaaaaattacagcactcaacggtgttgtatctgaatcatgctgttgctgattttgcggaagctttggctggtaaactccccggtgatct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26901613 |
ttgatcaaacgaaaaaattacagcactcaacggtgttgtatctgaatcatgctgttgctgattttgcggaagctttggctggtaaactccccggtgatct |
26901514 |
T |
 |
| Q |
103 |
taaggtaaactttgtttaacgttaccgtaatctcaattttgttactgtttagtttgatttaatagtaannnnnnnacggaatttgattctatatagtata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||| |
|
|
| T |
26901513 |
taaggtaaactttgtttaacgttaccgtaatctcaattttgttactgtttagtttgatttaatagtaatttttttacggaatttgattttatgtagtata |
26901414 |
T |
 |
| Q |
203 |
aatctttttcttataatcacatgctcaatggtttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26901413 |
aatctttttcttataatcacatgctcaatggtttc |
26901379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University