View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19307_low_39 (Length: 233)
Name: NF19307_low_39
Description: NF19307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19307_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 48398155 - 48398353
Alignment:
| Q |
16 |
aaaggaagaacctggaaaacctaagttttacccggttggaccattagtacagagagaagtagaagtaggtcaaattggaccgaactcagagagtttgaaa |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48398155 |
aaaggaagaaccaggaaaacctaagttttacccggttggaccattagtaaagagagaagtagaagtaggtcaaattggaccgaactcagagagtttgaaa |
48398254 |
T |
 |
| Q |
116 |
tggttagataatcaagcacacgggagtgttctgtttgtttcttttggaagtggtgggaccctctctagtaaacagatagttgaattggcacttggcttg |
214 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48398255 |
tggttagataatcaaccacatgggagtgttctgtttgtttcttttggaagtggtgggaccctctctagtaaacagatagttgaattggcacttggcttg |
48398353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University