View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19307_low_39 (Length: 233)

Name: NF19307_low_39
Description: NF19307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19307_low_39
NF19307_low_39
[»] chr7 (1 HSPs)
chr7 (16-214)||(48398155-48398353)


Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 48398155 - 48398353
Alignment:
16 aaaggaagaacctggaaaacctaagttttacccggttggaccattagtacagagagaagtagaagtaggtcaaattggaccgaactcagagagtttgaaa 115  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
48398155 aaaggaagaaccaggaaaacctaagttttacccggttggaccattagtaaagagagaagtagaagtaggtcaaattggaccgaactcagagagtttgaaa 48398254  T
116 tggttagataatcaagcacacgggagtgttctgtttgtttcttttggaagtggtgggaccctctctagtaaacagatagttgaattggcacttggcttg 214  Q
    ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48398255 tggttagataatcaaccacatgggagtgttctgtttgtttcttttggaagtggtgggaccctctctagtaaacagatagttgaattggcacttggcttg 48398353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University