View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19308_high_18 (Length: 345)
Name: NF19308_high_18
Description: NF19308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19308_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 196 - 331
Target Start/End: Original strand, 36971735 - 36971869
Alignment:
| Q |
196 |
ttgtgtatgggcattccctccccgtccaaagtttaaaacaaacacacctacataaatttccaagcacttgaaactaataaacacagacaagtcatatgca |
295 |
Q |
| |
|
|||||||||||||||||||||| ||||| || |||||||||||||||||||||||||| |||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
36971735 |
ttgtgtatgggcattccctccc-gtccacagattaaaacaaacacacctacataaattaccaagcacttgacactgataaacacagagaagtcatatgca |
36971833 |
T |
 |
| Q |
296 |
aatatagtttacttagcaacaatctacacttatgaa |
331 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36971834 |
aatatagtttacttagcaacaatctacacctatgaa |
36971869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 36956626 - 36956670
Alignment:
| Q |
19 |
tgtgtgtctattttgaccaatatgtatgtttatcttatcgtgtga |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36956626 |
tgtgtgtctattttgaccaatatgtatgtttctcttatcgtgtga |
36956670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 103 - 183
Target Start/End: Original strand, 36935879 - 36935959
Alignment:
| Q |
103 |
ataataattctatttacttgtttctttaatttctgtgtttcaccatgcatatcaattttatgattctttttggacacaaat |
183 |
Q |
| |
|
|||||||| |||||||| |||| ||||||||||| ||||| | ||||||| | |||||||||| ||||||| ||||||| |
|
|
| T |
36935879 |
ataataatgttatttactagtttgtttaatttctgcgtttctcgatgcataaccattttatgatgttttttgggcacaaat |
36935959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University