View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19308_high_24 (Length: 280)
Name: NF19308_high_24
Description: NF19308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19308_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 264
Target Start/End: Original strand, 35876211 - 35876462
Alignment:
| Q |
13 |
aaaatagtcacgggaaatcttatcaacctatctgcacaagaacttgtggactgtgaccctgctagcaagggttgtgctggaggtttttactttaatgcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35876211 |
aaaatagtcacgggaaatcttatcaacctatctgcacaagaacttgtggactgtgaccctgctagcaagggttgtgctggaggtttttactttaatgcat |
35876310 |
T |
 |
| Q |
113 |
ttggttatgttattgaaaatggtgggattgataccgaagctaactatccttatttagctaaaaatggcacttgcaaggtatgatttgcaattgttcattt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35876311 |
ttggttatgttattgaaaatggtgggattgatacagaagctaactatccttatttagctaaaaatggtacttgcaaggtatgatttgcaattgttcattt |
35876410 |
T |
 |
| Q |
213 |
tctcattcactatttgtcttttctaattattaagaaactttagtcacaatct |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35876411 |
tctcattcactatttgtcttttctaattaataagaaactttagtcacaatct |
35876462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 264
Target Start/End: Original strand, 24450412 - 24450663
Alignment:
| Q |
13 |
aaaatagtcacgggaaatcttatcaacctatctgcacaagaacttgtggactgtgaccctgctagcaagggttgtgctggaggtttttactttaatgcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24450412 |
aaaatagtcacgggaaatcttatcaacctatctgcacaagaacttgtggactgtgaccctgctagcaagggttgtgctggaggtttttactttaatgcat |
24450511 |
T |
 |
| Q |
113 |
ttggttatgttattgaaaatggtgggattgataccgaagctaactatccttatttagctaaaaatggcacttgcaaggtatgatttgcaattgttcattt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24450512 |
ttggttatgttattgaaaatggtgggattgatacagaagctaactatccttatttagctaaaaatggtacttgcaaggtatgatttgcaattgttcattt |
24450611 |
T |
 |
| Q |
213 |
tctcattcactatttgtcttttctaattattaagaaactttagtcacaatct |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24450612 |
tctcattcactatttgtcttttctaattaataagaaactttagtcacaatct |
24450663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University