View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19308_high_25 (Length: 277)
Name: NF19308_high_25
Description: NF19308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19308_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 259
Target Start/End: Original strand, 31105000 - 31105260
Alignment:
| Q |
13 |
aatattaagtgatgggggcaacaaatatatacatttgtagcatattgttgtttccaagaagaagaaaaaacactcctacgtttatttttgaagcgcttct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31105000 |
aatattaagtgatgggggcaacaaatatatacatttgtagcatattgttgtttccaagaagaagaaaaaacactcctacatttatttttgaagcgcttct |
31105099 |
T |
 |
| Q |
113 |
taacatgattcatatagaaaa--------------atgttaaaaacaaagtggggacacttgcagccacaatgattcacataagttcatcccttctaagg |
198 |
Q |
| |
|
|| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31105100 |
tagcatgattcatatagaaaaatgttaaggaaaaaatgttaaaaacaaagtggggacacttgcagccacaatgattcacataagttcatcccttctaagg |
31105199 |
T |
 |
| Q |
199 |
ttagcagtatcagctttactttgtgatttttgagtttgattctcaatttgtggtggatata |
259 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31105200 |
ttagcagtatcagctttactttgtggtttttgagtttgattctcaatttgtggtggatata |
31105260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University