View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19308_low_30 (Length: 265)
Name: NF19308_low_30
Description: NF19308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19308_low_30 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 265
Target Start/End: Original strand, 49951686 - 49951935
Alignment:
| Q |
16 |
gataggaaagtttcagttgatatcgaacttgtcgtttgttaattcccatagatcccacagctccaagccaaagtagctgagcgtgtgaatgatctcaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49951686 |
gataggaaagtttcagttgatatcgaacttgtcgtttgttaattcccatagatcccacagctccaagccaaagtagctgagcgtgtgaatgatctcaaaa |
49951785 |
T |
|
| Q |
116 |
ggtgtccttagttactgttgtagtaaaaatttaacataaaaaccaaaataaatccaaaccacattnnnnnnnnnnnnnnatgactcatcatcaccccctt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
49951786 |
ggtgtccttagttactgttgtagtaaaaatttaacataaaaaccaaaataaaaccaaaccacatttctctctctctctcatgactcatcatcaccccctt |
49951885 |
T |
|
| Q |
216 |
agcatctgtcacattttgttatcattgaacagatcaacacaatcacacac |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49951886 |
agcatctgtcacattttgttatcattgaacagatcaacacaatcacacac |
49951935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University