View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19308_low_8 (Length: 457)

Name: NF19308_low_8
Description: NF19308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19308_low_8
NF19308_low_8
[»] scaffold0288 (1 HSPs)
scaffold0288 (10-159)||(11278-11425)


Alignment Details
Target: scaffold0288 (Bit Score: 115; Significance: 3e-58; HSPs: 1)
Name: scaffold0288
Description:

Target: scaffold0288; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 10 - 159
Target Start/End: Complemental strand, 11425 - 11278
Alignment:
10 gcagagatacatattgaaattgtcaaggatgatgtgttcaatgcatttgataaggcaaatatttcgttggacaatgtgaattgagtgatgtttcttaatt 109  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||    
11425 gcagagatacatagtgaaattgtcaaggatgatgtgttcaatgcattttataaggtaaatatttcgttggacaatgtgaattgagtgatgtttcttaatt 11326  T
110 catatctttttgtcatctctcttttgaaatcactaaataacacttagcag 159  Q
    ||||||||||| |  ||||||||||||| |||||||||| ||||||||||    
11325 catatcttttttt--tctctcttttgaagtcactaaatagcacttagcag 11278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University