View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19309_low_8 (Length: 337)
Name: NF19309_low_8
Description: NF19309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19309_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 9e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 38 - 191
Target Start/End: Original strand, 9412383 - 9412536
Alignment:
| Q |
38 |
cacaacagcaattgaagttgcatcaatcacattcactgtgattctctgcaatatcaatgattgcaacagtttccacagccacaattcaaaaccttgtata |
137 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||| ||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| ||| |
|
|
| T |
9412383 |
cacaacaacaattgaagttgcatcagtcacatttactatgattctctgcaatatcaatgattgcaatagtatccacagccacaattcaaaaccttggata |
9412482 |
T |
 |
| Q |
138 |
ttagtagtttaaagtttaagaaactactcatcaacaacagttgaagttgggtca |
191 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
9412483 |
ttagtagtttatagtttaagaaactactcatgaacaacagttgaagttgcgtca |
9412536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University