View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1930_low_10 (Length: 255)
Name: NF1930_low_10
Description: NF1930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1930_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 7e-64; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 118 - 245
Target Start/End: Complemental strand, 29207112 - 29206985
Alignment:
| Q |
118 |
gacatatatacccctggttgcactctataaattgacccaatgtagttgcatgtttcctacatcacaaagaaaagatacattgataatactaagtgagaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29207112 |
gacatatatacccctggttgcactctataaattgacccaatgtagttgcatgtttcctacatcacaaagaaaagatacattgataatactaagtgagaaa |
29207013 |
T |
|
| Q |
218 |
gagatagtgataatggagttgatgatga |
245 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
29207012 |
gagatagtgataatggatttgatgatga |
29206985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 29207241 - 29207147
Alignment:
| Q |
1 |
atgaatcttatcatcttaagctttgggatgataatcatatt------------ataatcataaaattgtaaggcatgtgatgaatgcatcttttc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
29207241 |
atgaatcttatcatcttaagctttgggatgataatcatattataaacactattataatcataataatgtaaggcatgtgatgaatgcatcttttc |
29207147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 208 - 245
Target Start/End: Complemental strand, 29158416 - 29158379
Alignment:
| Q |
208 |
aagtgagaaagagatagtgataatggagttgatgatga |
245 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
29158416 |
aagtgagaaaaagatagtgataatggtgttgatgatga |
29158379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University