View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1930_low_12 (Length: 247)
Name: NF1930_low_12
Description: NF1930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1930_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 78 - 229
Target Start/End: Complemental strand, 4203378 - 4203227
Alignment:
| Q |
78 |
ctctttaccttcatcagcttccttaagtgttggttttggcatttttccacttctcactgctacaccttgcatgccacaacaacaatctcaaaacaatgaa |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4203378 |
ctctttaccttcatcagcttcattaagtgttggttttggcatttttccacttctcactgctacaccttgcatgccacaacaacaatctcaaaacaatgaa |
4203279 |
T |
 |
| Q |
178 |
gttcaagaaaatcctagtaacaataacaatttttggaaccttaggatgtgtc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4203278 |
gttcaagaaaatcctagtaacaataacaatttttggaatcttaggatgtgtc |
4203227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University