View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1930_low_13 (Length: 243)

Name: NF1930_low_13
Description: NF1930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1930_low_13
NF1930_low_13
[»] chr7 (1 HSPs)
chr7 (24-156)||(29207335-29207461)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 24 - 156
Target Start/End: Original strand, 29207335 - 29207461
Alignment:
24 aatatattataatagatatagatgttgatcataacaattaacaattcataacaattaacaatcgatctgccttcaacaatnnnnnnnnncaattaacaat 123  Q
    |||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||          ||   |||||    
29207335 aatatattataatagatacagatgttgatcataataattaataattcataacaattaacaatcgatctgccttcaacaataaaa------aaaacacaat 29207428  T
124 tgatctagagcctacagcatgatcctcgtggcc 156  Q
    |||||||||||||||||||||||||||||||||    
29207429 tgatctagagcctacagcatgatcctcgtggcc 29207461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University