View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1930_low_15 (Length: 239)
Name: NF1930_low_15
Description: NF1930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1930_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 63 - 227
Target Start/End: Complemental strand, 18253589 - 18253422
Alignment:
| Q |
63 |
gtgaaggaaaccattgaaa-ttttttattttagaaagaaaccattgaaaca--gatactcaattatatgatgttactacatgtttgcttaaatataaaat |
159 |
Q |
| |
|
||||||||||||||||||| |||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18253589 |
gtgaaggaaaccattgaaactttttttttttaggaagaaaccattgaaacatagatactcaattatatgatgttactacatgtttgcttaaatataaaat |
18253490 |
T |
|
| Q |
160 |
gagaagtgcacaaacnnnnnnncaaaccaaatattaggaaaatacagcacgtacgtttattcatctca |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
18253489 |
gagaagtgcacaaacaaaaaaacaaaccaaatattaggaaaatacaacatgtacgtttattcatctca |
18253422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 18253626 - 18253597
Alignment:
| Q |
19 |
ataacaaacttttggtctcaattataactt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18253626 |
ataacaaacttttggtctcaattataactt |
18253597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University