View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19312_high_17 (Length: 402)
Name: NF19312_high_17
Description: NF19312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19312_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 1 - 388
Target Start/End: Complemental strand, 35697165 - 35696778
Alignment:
| Q |
1 |
tcgtgttcaacatctccccgccattgtccttctccggcggccatttctcaaacattgaattattcaccgtctttcttggcacgtgcaatggcaacggata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35697165 |
tcgtgttcaacatctccccgccattgtccttctccggcggccatttctcaaacattgaattattcaccgtctttcttggcacgtgcaatggcaacggata |
35697066 |
T |
 |
| Q |
101 |
caatcctttcgctatcgcggcagccaccacagacggtgaaggtccaacatccgaacacaacgatccattcgcgttcacgatcacacctttcttcccagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35697065 |
caatcctttcgctatcgcggcagccaccacagacggtgaaggtccaacatccgaacacaacgatccattcgcgttcacgatcacacctttcttcccagta |
35696966 |
T |
 |
| Q |
201 |
ggaacactaatttcagactcacattcaccaccgtaaccgttttttccattaggattataaacataatcattaatcgtcgaatcannnnnnncgctttgtg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35696965 |
ggaacactaatttcagactcacattcaccaccgtaaccgttttttccattaggattataaacataatcattaatcgtcgaatcatttttttcgctttgtg |
35696866 |
T |
 |
| Q |
301 |
atcgttgaagcgtcatcatatgcttggcatcacaattactgttattgtcatagttttgattctgtttgttaggcttcgttatatcata |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696865 |
atcgttgaagcgtcatcatatgcttggcatcacaattactgttattgtcatagttttgattctgtttgttaggcttcgttatatcata |
35696778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University