View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19312_high_23 (Length: 344)
Name: NF19312_high_23
Description: NF19312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19312_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-172; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 24 - 340
Target Start/End: Original strand, 30325555 - 30325871
Alignment:
| Q |
24 |
cactcgcttccccggcgacctctgtcgcttcccaccacccggcattgtttgccgttactcctactttcattttcttcagtatcgcaaatttaaatcacac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30325555 |
cactcgcttccccggcgacctctgtcgcttcccaccacccggcattgtttgccgttactcctactttcattttcttcagtatcgcaaatttaaatcacac |
30325654 |
T |
 |
| Q |
124 |
attgaacaacttcactttggcaactacgtttttgatgaaagaccaaccctactaccatgttcttcccataatgccactctcaacccacttctcttcaccc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30325655 |
attgaacaacttcactttggcaactacgtttttgatgaaagaccaaccctactaccatgttcttcccataatgccactctcaacccacttctcttcaccc |
30325754 |
T |
 |
| Q |
224 |
ctttcaactacctccgattactcaccttccgtgaatgcttcaacaacccagaaaaccccattaacctctctctttccccttttcctccatctctagaaca |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30325755 |
ctttcaactacctccgattactcaccttccgtgaatgcttcaacaacccagaaaaccccattaacctctctctttcccctttccctccatctctagaaca |
30325854 |
T |
 |
| Q |
324 |
tcttatattcttcgaca |
340 |
Q |
| |
|
|||||| ||||| |||| |
|
|
| T |
30325855 |
tcttattttctttgaca |
30325871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 25 - 111
Target Start/End: Original strand, 30337193 - 30337279
Alignment:
| Q |
25 |
actcgcttccccggcgacctctgtcgcttcccaccacccggcattgtttgccgttactcctactttcattttcttcagtatcgcaaa |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
30337193 |
actcgcttctccggcgacctctgtcgcttacccccacccggcgttgtttgccgttactcctactttcatcttcttaagtatcgcaaa |
30337279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 213 - 271
Target Start/End: Original strand, 30337381 - 30337439
Alignment:
| Q |
213 |
tctcttcacccctttcaactacctccgattactcaccttccgtgaatgcttcaacaacc |
271 |
Q |
| |
|
||| |||||||||||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
30337381 |
tcttttcacccctttcaactaccttggaaaactcatcttccgtgaatgcttcaacaacc |
30337439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 202 - 270
Target Start/End: Original strand, 30332972 - 30333040
Alignment:
| Q |
202 |
ctcaacccacttctcttcacccctttcaactacctccgattactcaccttccgtgaatgcttcaacaac |
270 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
30332972 |
ctcaacccaatactcttaacccctttcaactacctccgcaaactcacattccacaaatgcttcaacaac |
30333040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University