View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19312_high_26 (Length: 294)
Name: NF19312_high_26
Description: NF19312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19312_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 21 - 285
Target Start/End: Original strand, 33398781 - 33399045
Alignment:
| Q |
21 |
atccaagagttaccgaattttgtatacgggagatgacacaggtcacatgactatcacacgcactgctgtccggcttgacaaggccaggcttgagctatgc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33398781 |
atccaagagttaccgaattttgtatacgggagatgacaaaggtcacatgactatcacacgcactgctgtccggcttgacaaggccaggcttgagctatgc |
33398880 |
T |
|
| Q |
121 |
ggtgttttattttttgcggactatgcgtcgctgtccggctcgacaagccattcaaaaacctgtctactttgcaatactaataagaaagttctactttgtt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33398881 |
ggtgttttattttttgcggactatgcgtcgctgtccggctcgacaagccattcaaaaacctgtctactttgcaatactaataagaaagttctactttgtt |
33398980 |
T |
|
| Q |
221 |
caatgttagttttaagataactttatttaccataaatcatagtaacaccagtacacaatattctt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33398981 |
caatgttagttttaagataactttatttaccataaatcatagtaacaccagtacacaattttctt |
33399045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University