View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19312_high_30 (Length: 275)
Name: NF19312_high_30
Description: NF19312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19312_high_30 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 27 - 275
Target Start/End: Complemental strand, 4702212 - 4701964
Alignment:
| Q |
27 |
gtgttggtgttgtgttcggtgtctctactttattacgcaatgcaatgaataatttaaccttggtgtcaagcatgatggaaataactctatcttgaaactg |
126 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702212 |
gtgtcggtgttgtgttcggtgtctctgctttattacgcaatgcaatgaataatttaaccttggtgtcaagcatgatggaaataactctatcttgaaactg |
4702113 |
T |
 |
| Q |
127 |
agaattgtattgtttaacaaaatcaatagttttctgatgggaagtgtggtccccgtgtgacatgttcaagcgggccacattcattccagtttcagccagt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
4702112 |
agaattgtattgtttaacaaaatcaatagctttctgatgggaagtgtggtccccgtgtgacatgttcaaacgcgccacattcattccagtttcagccagt |
4702013 |
T |
 |
| Q |
227 |
ttccaaatcatgtcacgtgagctagtagatggaccaatcgtgcacacga |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702012 |
ttccaaatcatgtcacgtgagctagtagatggaccaatcgtgcacacga |
4701964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University