View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19312_high_40 (Length: 217)
Name: NF19312_high_40
Description: NF19312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19312_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 25896374 - 25896190
Alignment:
| Q |
17 |
acagattaaatcagcattagggaatgcttcaactgtaatatgcaccattggtgccagtgagaaggaaattttcgacattaccggaccttatcgaatagat |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25896374 |
acagattaaatcagcattagggaatgcatcaactgtaatatgcaccattggtgccagtgagaaggaaattttcgacattaccggaccttatcgaatagat |
25896275 |
T |
 |
| Q |
117 |
tacatggccaccaaaaacctagttgatgccggtaacaagagcttttattatggttatgtttcaatgctatttgttttaagcttaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||||| |
|
|
| T |
25896274 |
tacatggccaccaaaaacctagttgatgccggtaacaagagcttttattatgtttctgtttcaatgctatttgttttaggcttaa |
25896190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University