View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19312_high_41 (Length: 213)
Name: NF19312_high_41
Description: NF19312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19312_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 104 - 204
Target Start/End: Complemental strand, 11484948 - 11484848
Alignment:
| Q |
104 |
ttacctatatttttaataggctaaatcaactttaaacttattctattggactaatatgaatgaatctacacatttagattcaaaggtcttttgccaacaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11484948 |
ttacctatatttttaataggctaaatcaactttaaacttattctattggactaatatgaatgaatctaaacatttagattcaaaggtcttttgccaacaa |
11484849 |
T |
 |
| Q |
204 |
g |
204 |
Q |
| |
|
| |
|
|
| T |
11484848 |
g |
11484848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 11 - 71
Target Start/End: Complemental strand, 11485041 - 11484981
Alignment:
| Q |
11 |
caaaactaaatatatagtatttggtggaatgtatgaatgagttttactatatcaaattgtc |
71 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11485041 |
caaaattaaatatatagtatttggtggaatgtatgaaagagttttactatatcaaattgtc |
11484981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University