View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19312_high_44 (Length: 209)
Name: NF19312_high_44
Description: NF19312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19312_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 22 - 192
Target Start/End: Original strand, 46379904 - 46380074
Alignment:
| Q |
22 |
ttgtttcagaattgaggtttgttaaggtcgtgtcttttcttataggaaggacaacaaaattcttccccagcaaccggggaaaagggtgaggttttgatca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46379904 |
ttgtttcagaattgaggtttgttaaggtcgtctcttttcttataggaaggacgccaaaattcttccccagcaaccggggaaaagggtgaggttttgatca |
46380003 |
T |
 |
| Q |
122 |
aagttttgagagaactaaccaccgtccaaagaaaaatagctgatttgcaagtcgaactccaaggtcgaaag |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46380004 |
aagttttgagagaactaaccaccgtccaaagaaaaatagctgatttgcaagtcgaactccaaggtcgaaag |
46380074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 185
Target Start/End: Original strand, 25754848 - 25754918
Alignment:
| Q |
115 |
ttgatcaaagttttgagagaactaaccaccgtccaaagaaaaatagctgatttgcaagtcgaactccaagg |
185 |
Q |
| |
|
||||||| |||||||||||| |||| | || ||||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
25754848 |
ttgatcagggttttgagagaattaacttctgttcaaagaaaaattgctgatttgcaagttgaacttcaagg |
25754918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University