View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19312_high_45 (Length: 201)
Name: NF19312_high_45
Description: NF19312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19312_high_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 38481192 - 38481026
Alignment:
| Q |
20 |
ttctgaattctctcacgcttttgtattttctagcaatcactttctttatctgtttctaatcccctaannnnnnnnnnnnnncttgcaaaaattccagttt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38481192 |
ttctgaattctctcacgcttttgtattttctagcaatcactttctttatctgtttctaatcccctaattttttatttttttcttgcaaaaattccagttt |
38481093 |
T |
|
| Q |
120 |
agcagtatttgatgttcttctcattgttgcttattttcgattggtttacaatctccttcattctgtg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
38481092 |
agcagtatttgatgttcttctcattgttgcttattttcgattggttgacaatctccttgattctgtg |
38481026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University