View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19312_low_31 (Length: 276)
Name: NF19312_low_31
Description: NF19312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19312_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 33212880 - 33213132
Alignment:
| Q |
1 |
catttgtgtttttgtttttatataattgatgcttttcataaaactaaccatctatcaataatttaaaataataaaatgaacataattctatcaacaatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33212880 |
catttgtgtttttgtttttatataattgatgcttttcataaaactaaccatctatcaataatttgaaataataaaatgaacataattctatcaacaatca |
33212979 |
T |
 |
| Q |
101 |
aaacaaccactaatgagataattgtctagcagataagaatgagagtgaccatgaacttctacttttcaaagatgattgatcgtcgacaaatgtttattat |
200 |
Q |
| |
|
|||||||||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||||||| |
|
|
| T |
33212980 |
aaacaaccactaatcagataattgtctcgccgataagaatgagagtgaccatgaacttctacttttcaaagatgtttgatcgtcgataaacgtttattat |
33213079 |
T |
 |
| Q |
201 |
gatttttatactatgaatcgttaaaatccgttttttaacataattgattataga |
254 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
33213080 |
gatttttatactatgaatcgttaaaacccg-cttttaacataatcgattataga |
33213132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University