View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19312_low_40 (Length: 243)
Name: NF19312_low_40
Description: NF19312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19312_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 2584355 - 2584565
Alignment:
| Q |
18 |
aaactagaaggcccacatatctcttccttgctcctccttaaagctaagtacaatcattttctcttttcacaattccttataaaatgtc-tttttaaatat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2584355 |
aaactagaaggcccacatatctcttccttgctcctccttaaagctaagtacaatcattttctcttttcacaattccttataaaatgtcttttttaaatat |
2584454 |
T |
 |
| Q |
117 |
caatttgtatatattactttcaaagttttagcttgcgattcatacaagcaaatgtccannnnnnnnctttcttgcacatcaacttggtggttcactagca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2584455 |
caatttgtatatattactttcaaagttttagcttgcgattcatacaagcaaatgtcca-tttttttctttcttgcacatcaacttggtggttcactagca |
2584553 |
T |
 |
| Q |
217 |
tcaatcaacttt |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2584554 |
tcaatcaacttt |
2584565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University