View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19312_low_48 (Length: 213)

Name: NF19312_low_48
Description: NF19312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19312_low_48
NF19312_low_48
[»] chr5 (2 HSPs)
chr5 (104-204)||(11484848-11484948)
chr5 (11-71)||(11484981-11485041)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 104 - 204
Target Start/End: Complemental strand, 11484948 - 11484848
Alignment:
104 ttacctatatttttaataggctaaatcaactttaaacttattctattggactaatatgaatgaatctacacatttagattcaaaggtcttttgccaacaa 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
11484948 ttacctatatttttaataggctaaatcaactttaaacttattctattggactaatatgaatgaatctaaacatttagattcaaaggtcttttgccaacaa 11484849  T
204 g 204  Q
    |    
11484848 g 11484848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 11 - 71
Target Start/End: Complemental strand, 11485041 - 11484981
Alignment:
11 caaaactaaatatatagtatttggtggaatgtatgaatgagttttactatatcaaattgtc 71  Q
    ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
11485041 caaaattaaatatatagtatttggtggaatgtatgaaagagttttactatatcaaattgtc 11484981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University