View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19314_high_7 (Length: 361)
Name: NF19314_high_7
Description: NF19314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19314_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 17136343 - 17136248
Alignment:
| Q |
1 |
ggaagattctgcatatttcatacaaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagcttgttgtgaag |
96 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17136343 |
ggaagattctgcagatttcatacaaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagcttgttgtgaag |
17136248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 95 - 200
Target Start/End: Complemental strand, 17136132 - 17136027
Alignment:
| Q |
95 |
agatcaccatcagatgcagaattctagcataacttgtcctgcatatcagaagaaggcagactgatattgtggatttgagcagttagagcagcatctctgt |
194 |
Q |
| |
|
||||| ||||||| ||||| |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17136132 |
agatccccatcagctgcagtattccagcataacttgtcctgcatatcagaagaaggcagggtgatattgtggatttgagcagttagagcagcatctctat |
17136033 |
T |
 |
| Q |
195 |
gaatga |
200 |
Q |
| |
|
|||||| |
|
|
| T |
17136032 |
gaatga |
17136027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 6937314 - 6937409
Alignment:
| Q |
1 |
ggaagattctgcatatttcatacaaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagcttgttgtgaag |
96 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6937314 |
ggaagattctgcagatttcatacaaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagcttgttgtgaag |
6937409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 88
Target Start/End: Original strand, 24718322 - 24718386
Alignment:
| Q |
24 |
aaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagcttg |
88 |
Q |
| |
|
||||||| |||||||||||||| | || || || |||||||| ||||||||||||||||||||| |
|
|
| T |
24718322 |
aaaaacaacaaatagagacaattatacaacctctatttcttaagttttcatctgtggggagcttg |
24718386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 87
Target Start/End: Original strand, 25639126 - 25639190
Alignment:
| Q |
23 |
caaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagctt |
87 |
Q |
| |
|
|||||||| |||| ||| ||||| | |||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
25639126 |
caaaaacaacaaacagacacaataatgcagcccctcttacgcaaattttcatctgttgggagctt |
25639190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University