View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19314_low_11 (Length: 285)
Name: NF19314_low_11
Description: NF19314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19314_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 153 - 270
Target Start/End: Original strand, 30519341 - 30519454
Alignment:
| Q |
153 |
actaaatagtaaggaactacactatacatatatatgtctttcaaatgtatacattgcagcttatatatgtttgtatactatttctatttctattttggta |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30519341 |
actaaatagtaaggaactacactatacatatatatgtctttcaaatgtatacattgcagct----tatgtttgtatactatttctatttctattttggta |
30519436 |
T |
 |
| Q |
253 |
aggtgtcttcaatctttt |
270 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30519437 |
aggtgtcttcaatctttt |
30519454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 30519192 - 30519262
Alignment:
| Q |
1 |
tgacacatatgatgaggttggaagaaagttgatctccatttggaatgattatcccataatttgttcttgct |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30519192 |
tgacacatatgatgaggttggaagaaagttgatctccatttggaatgattatcccataatttgttcttgct |
30519262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University