View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19314_low_12 (Length: 253)
Name: NF19314_low_12
Description: NF19314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19314_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 64530 - 64318
Alignment:
| Q |
16 |
aatatggtgtgatttatatttttaattatttgatatatatataaaaacccttcaattcaggcatcttaataaaacaaaactcatatttaaacttttcaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
64530 |
aatatggtgtgatttatatttttaattatttgatatatata--aaaaccttttaattcaggcatcttaataaaacaaaactcatatttaaatttttcaaa |
64433 |
T |
 |
| Q |
116 |
accgatccaacactcaaaattgaaacatgaattattcaatcttaattcaatgatacaaaatcacatcaacgtgatctgtgacgacaaacattttattttc |
215 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
64432 |
accgatccaacatttaaaattgaaacatgaatcattcaatcttaattcaatgatacaaaatcacatcaacgtgatttgtgacgacaaacattttattttc |
64333 |
T |
 |
| Q |
216 |
gacgcaagccataac |
230 |
Q |
| |
|
|||||| | |||||| |
|
|
| T |
64332 |
gacgcacgtcataac |
64318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University