View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19314_low_5 (Length: 401)
Name: NF19314_low_5
Description: NF19314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19314_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 66 - 269
Target Start/End: Original strand, 30789305 - 30789508
Alignment:
| Q |
66 |
caaactagaaaacggtcaaattagcaagacaaacnnnnnnntatgcaagaagagcagttgaatttggaattgtcaaagatattgaaaattgaaatcaccc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30789305 |
caaactagaaaacggtcaaattagcaagacaaacaaaaaaatatgcaagaagagcagttgaatttgcaattgtcaaagatattgaaaattgaaatcaccc |
30789404 |
T |
|
| Q |
166 |
caaaagaaggagaaaaatattcaaataatataatgggtgataatcgatcaccaacgccacctcgaaggagaaatttgggtgatttcgtctagaatcaatt |
265 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30789405 |
caaaagaaggagaaaaatattcaactaatataatgggtgataatcgatcaccaacgccacctcgaaggagaaatttgggtgatttcgtctcaaatcaatt |
30789504 |
T |
|
| Q |
266 |
gaac |
269 |
Q |
| |
|
|||| |
|
|
| T |
30789505 |
gaac |
30789508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 322 - 383
Target Start/End: Original strand, 30789562 - 30789623
Alignment:
| Q |
322 |
gaaaatattgtttcaacaaaagatcgtttccactttggcgaccattttctaaatcctcgagt |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30789562 |
gaaaatattgtttcaacaaaagatcgtttccactttggcgaccattttctaaatcctcgagt |
30789623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University