View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19315_high_1 (Length: 337)
Name: NF19315_high_1
Description: NF19315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19315_high_1 |
 |  |
|
| [»] scaffold0115 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 103 - 307
Target Start/End: Original strand, 31003115 - 31003319
Alignment:
| Q |
103 |
aaggcttcgacaatctattaggctgcatggctggaatgaagctaaaactctgcagcatcaccgggcttaatctgaagcagtgaagctcactttttaaaca |
202 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31003115 |
aaggcttcggcaatctattaggctgcatggctggaatgaagctaaaactctgcagcatcaccaggcttaatctgaagcagtgaagctcactttttaaaca |
31003214 |
T |
 |
| Q |
203 |
ccttaggacgcatggcttgaacgaagctaaaactagcatcaccgaagctaaagaacaaaaaccggtgcaccataatactatagaaccccaaaattttgca |
302 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31003215 |
ccttagggtgcatggcttgaacgaagctaaaactagcatcaccgaagctaaagaacaaaaatcagtgcaccataatactatagaaccccaaaattttgca |
31003314 |
T |
 |
| Q |
303 |
gcatc |
307 |
Q |
| |
|
||||| |
|
|
| T |
31003315 |
gcatc |
31003319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 183 - 307
Target Start/End: Complemental strand, 2531250 - 2531127
Alignment:
| Q |
183 |
tgaagctcactttttaaacaccttaggacgcatggcttgaacgaagctaaaact----agcatcaccgaagctaaagaacaaaaaccggtgcaccataat |
278 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||| |||||||||||||||| ||||||| | | ||||||||||| |||| | | ||||| | |
|
|
| T |
2531250 |
tgaagctcacttgcttgacaccttaggacgcatggctggaacgaagctaaaactccaaagcatcatcaacgctaaagaacacaaactgatacaccaaa-- |
2531153 |
T |
 |
| Q |
279 |
actatagaaccccaaaattttgcagcatc |
307 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2531152 |
---ctagaaccccaaaattttgcagcatc |
2531127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0115 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 307
Target Start/End: Original strand, 38715 - 38838
Alignment:
| Q |
183 |
tgaagctcactttttaaacaccttaggacgcatggcttgaacgaagctaaaact----agcatcaccgaagctaaagaacaaaaaccggtgcaccataat |
278 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||| |||||||||||||| | ||||||| | ||||||||||||| |||| | | ||||| | |
|
|
| T |
38715 |
tgaagctcacttgcttgacaccttaggacacatggctagaacgaagctaaaattccgaagcatcatcaaagctaaagaacacaaactgatacaccaaa-- |
38812 |
T |
 |
| Q |
279 |
actatagaaccccaaaattttgcagcatc |
307 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38813 |
---ctagaaccccaaaattttgcagcatc |
38838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University