View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19315_high_2 (Length: 280)
Name: NF19315_high_2
Description: NF19315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19315_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 262
Target Start/End: Original strand, 26621294 - 26621540
Alignment:
| Q |
16 |
agcacagacactacacattggacatccacaaacaagtgtaagaaggtaagattcaagttcttctgaaagtttatcgagagcagtaaaaaatttaaaaaca |
115 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26621294 |
agcacaaacgctacacattggacatccacaaactagtgtaagaaggtaagattcaagttcttctgaaagtttatcgagagcagtaaaaaatttaaaaaca |
26621393 |
T |
 |
| Q |
116 |
aatctagatccttgattgaggcagtaactcacactgaagatcaaggagatatttatagctcgagtctaacaaactctaactaatctatgaaactaacttc |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26621394 |
aatctagatccttgattgaggtagtaactcacactgaagatcaaggagatatttatagctcgagtctaacaaactctaactaatctatgaaactaacttc |
26621493 |
T |
 |
| Q |
216 |
tgataaccttgctgaatgccgagtgaacacaatagaaaatataaagt |
262 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
26621494 |
tgataaccttgctgaatgtcgagtcaacacaatagaaaagataaagt |
26621540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University