View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19315_high_3 (Length: 242)
Name: NF19315_high_3
Description: NF19315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19315_high_3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 242
Target Start/End: Original strand, 26621091 - 26621324
Alignment:
| Q |
9 |
gaagaatatcaagtaaatatccctatggagattgctatgcagcttgaagtagcataacaaaaccagtgaaactccactccagtggtgattgcagatgccg |
108 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26621091 |
gaagaaaatcaagtaaatatccctacggagattgctatgcagcttgaagtagcataacaaaaccagtgaaactccactccagtggtgattgcagatgccg |
26621190 |
T |
|
| Q |
109 |
tttcgattccgatgaagtcgcgtcgaggaggaggcaacaaacctccagatgattcagactagggaagcagcaatcgttcacctaattgatgcggtctcag |
208 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||| ||| |
|
|
| T |
26621191 |
tttcgattctgatgaagttgcgtcgaggaggaggcgacaaacctccagatgattcagactagggaagcagcaatcattcacctcattgacgcggtcgcag |
26621290 |
T |
|
| Q |
209 |
agcagcacaaacactacacattggacatccacaa |
242 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
26621291 |
agcagcacaaacgctacacattggacatccacaa |
26621324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University