View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19315_low_13 (Length: 241)
Name: NF19315_low_13
Description: NF19315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19315_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 5 - 224
Target Start/End: Original strand, 33017045 - 33017267
Alignment:
| Q |
5 |
taaaaggcatgttatgtgnnnnnnncttttagacaaaacatgttatgtggttttgtcttgtagttactattttgcaaat--aacgacgttaaatatttta |
102 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33017045 |
taaaaggcatgttatgtgtttttttcattttgacaaaacatgttatgtggttttgtcttgtagttactattttgcaaattaaacgacgttaaatatttta |
33017144 |
T |
|
| Q |
103 |
tctaatctgcatgtaggatatatctatacat-tttttgcagaatttatggattctataaaatctgtggaggcataaagatgtccacatcgtttcaagnnn |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33017145 |
tctaatctgcatgtaggatatatctatacatctttttgcagaatttatggattctataaaatctgtgggggcataaagatgtccacatcgtttcaagaaa |
33017244 |
T |
|
| Q |
202 |
nnnntaaagatgtccacatacct |
224 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33017245 |
aaaataaagatgtccacatacct |
33017267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University