View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19315_low_3 (Length: 385)
Name: NF19315_low_3
Description: NF19315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19315_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 2e-90; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 3 - 175
Target Start/End: Original strand, 375953 - 376125
Alignment:
| Q |
3 |
gagtataaaacagcagttgtggaggatggtggaattcaggttgatcaattgttctttcatgatccagatggatatatgattgaaatgtgcaattgccaaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
375953 |
gagtataaaacagcagttgtggaggatggtggaattaaggttgatcaattgttctttcatgatccagatggatatatgattgaaatgtgcaattgccaaa |
376052 |
T |
|
| Q |
103 |
atctccctgtgcttcctatttccacttgccctctaaagcagccaactaatcaagcaccagtacccttttatgg |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
376053 |
atctccctgtgcttcctatttccacttgccctctaaagcagccaactaatcaagcaccagtacccttttatgg |
376125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 195 - 370
Target Start/End: Original strand, 376153 - 376324
Alignment:
| Q |
195 |
gttttcttctcaactctcctaattaattaatttctttaatttgtttcgtttaaatttaatccaatgattactacaatgaaattgaaaagcttaatttata |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
376153 |
gttttcttctcaactctcctaattaattaatttcttt----tgtttcgtttaaatttaatccaatgattactacaatgaaattgaaaagcttaatttata |
376248 |
T |
|
| Q |
295 |
tccaaattggacatgtttttgcaggagaaggaaagaactgccatgcagaagaagctttgctgatgatggagatttt |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
376249 |
tccaaattggacatgtttttgcaggagaaggaaagaactgccatgcagaagaagctttgctgatgatggagatttt |
376324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 32 - 97
Target Start/End: Complemental strand, 44544876 - 44544811
Alignment:
| Q |
32 |
tggaattcaggttgatcaattgttctttcatgatccagatggatatatgattgaaatgtgcaattg |
97 |
Q |
| |
|
||||||||| || ||||||||||| |||||||| |||||||||| |||||||||||| |||||||| |
|
|
| T |
44544876 |
tggaattcaagtggatcaattgttttttcatgacccagatggatttatgattgaaatatgcaattg |
44544811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 32 - 97
Target Start/End: Complemental strand, 44555518 - 44555453
Alignment:
| Q |
32 |
tggaattcaggttgatcaattgttctttcatgatccagatggatatatgattgaaatgtgcaattg |
97 |
Q |
| |
|
||||||||| || ||||||||||| |||||||| |||||||||| |||||||||||| |||||||| |
|
|
| T |
44555518 |
tggaattcaagtggatcaattgttttttcatgacccagatggatttatgattgaaatatgcaattg |
44555453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University