View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19317_low_5 (Length: 373)
Name: NF19317_low_5
Description: NF19317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19317_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 20 - 152
Target Start/End: Complemental strand, 31046422 - 31046290
Alignment:
| Q |
20 |
ttcttaagaatatgagtaaacaaaccggtaggaagagacaaatcaaattcattcacgacaatatgtcaaattggagtgtgtgaagagaagaagatgaaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31046422 |
ttcttaagaatatgagtaaacaaaccggtaggaagagacaaatcaaattcattcacgacaatatgttaaattggagtgtgtgaagagaagaagatgaaga |
31046323 |
T |
|
| Q |
120 |
tggaagtttagtgatttagtgctttggtatttg |
152 |
Q |
| |
|
||| ||| ||||||||||||| ||||||||||| |
|
|
| T |
31046322 |
tggcagtgtagtgatttagtggtttggtatttg |
31046290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 275
Target Start/End: Complemental strand, 31103398 - 31103361
Alignment:
| Q |
238 |
ttagtggtttattattagatttaatagtcttgcatgat |
275 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
31103398 |
ttagtggtttattattagatttaatggtcttgtatgat |
31103361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 241 - 275
Target Start/End: Complemental strand, 9559317 - 9559283
Alignment:
| Q |
241 |
gtggtttattattagatttaatagtcttgcatgat |
275 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
9559317 |
gtggtttattattagattcaatagtcttgcatgat |
9559283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University