View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19319_low_19 (Length: 226)
Name: NF19319_low_19
Description: NF19319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19319_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 49654859 - 49655069
Alignment:
| Q |
1 |
ctgattttgtttgttctgttataggatagttttgttatggtaattttgtaattgacacaagtttagcttatagtatgtggtttatgtccttagtttagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49654859 |
ctgattttgtttgttctgttataggatagttttgttatggtaattttgtaattgacacaagtttagcttatagtatgtggtttatgtccttagtttagtc |
49654958 |
T |
 |
| Q |
101 |
ggggggctaattttacatttagaagatcttagtcttaacactggaaatgctctgctcatagctttagcttattttgattttggactaaactgtaaatgat |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49654959 |
gggg--ctaattttacatttagaagatcttagtcttaacactggaaatgctctgctcatagctttagcttattttgattttggactaaactgtaaatgat |
49655056 |
T |
 |
| Q |
201 |
gttctaatagcct |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49655057 |
gttctaatagcct |
49655069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 143
Target Start/End: Complemental strand, 8551537 - 8551505
Alignment:
| Q |
111 |
ttttacatttagaagatcttagtcttaacactg |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
8551537 |
ttttacatttagaagatcttagtcttgacactg |
8551505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University