View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1931_low_11 (Length: 237)
Name: NF1931_low_11
Description: NF1931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1931_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 122 - 227
Target Start/End: Original strand, 42206698 - 42206803
Alignment:
| Q |
122 |
agagctagtagtaaatcaaaataaatactacatattttatggaaaaatagttattaatttcataaaaatccagtcatgtaatgaaattgaaaatcaactt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42206698 |
agagctagtagtaaatcaaaataaatactacatattttatggaaaaatagttattaatttcataaaaatccagtcatgtaatgaaattgaaaatctactt |
42206797 |
T |
 |
| Q |
222 |
ttatct |
227 |
Q |
| |
|
|||||| |
|
|
| T |
42206798 |
ttatct |
42206803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 42205853 - 42205928
Alignment:
| Q |
1 |
atcatgaaatctctacccctattctctatgtttctctcatactagcatttcaatttgaataatttggggcatgggg |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42205853 |
atcatgaaatctctacccctattctctatgtttctctcatactagcatttcaatttgaataatttggggcatgggg |
42205928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University