View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1931_low_11 (Length: 237)

Name: NF1931_low_11
Description: NF1931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1931_low_11
NF1931_low_11
[»] chr5 (2 HSPs)
chr5 (122-227)||(42206698-42206803)
chr5 (1-76)||(42205853-42205928)


Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 122 - 227
Target Start/End: Original strand, 42206698 - 42206803
Alignment:
122 agagctagtagtaaatcaaaataaatactacatattttatggaaaaatagttattaatttcataaaaatccagtcatgtaatgaaattgaaaatcaactt 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
42206698 agagctagtagtaaatcaaaataaatactacatattttatggaaaaatagttattaatttcataaaaatccagtcatgtaatgaaattgaaaatctactt 42206797  T
222 ttatct 227  Q
    ||||||    
42206798 ttatct 42206803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 42205853 - 42205928
Alignment:
1 atcatgaaatctctacccctattctctatgtttctctcatactagcatttcaatttgaataatttggggcatgggg 76  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42205853 atcatgaaatctctacccctattctctatgtttctctcatactagcatttcaatttgaataatttggggcatgggg 42205928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University