View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1931_low_9 (Length: 292)
Name: NF1931_low_9
Description: NF1931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1931_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 283
Target Start/End: Complemental strand, 35314440 - 35314175
Alignment:
| Q |
18 |
agttattggaagaccaaagtgtttgcattattctttttactaccgcaaagaaccttcatccatcctggtcaattttctcgtagatttgggacggtgtttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35314440 |
agttattggaagaccaaagtgtttgcactattctttttactaccgcaaagaaccttcatccatcctggtcaattttctcgtagatttgggacggtgtttt |
35314341 |
T |
 |
| Q |
118 |
ctttttttgtaaataaaagcacagnnnnnnnnnnctttctttccgggctgcaagaattaaaagatttttatcttctgttgttgacacttgacaccnnnnn |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35314340 |
ctttttttgtaaataaaagcacagttttttttttctttctttctgggctgcaagaattaaaagatttttatcttctgttgttgacacttgacaccaaaaa |
35314241 |
T |
 |
| Q |
218 |
nntgttttatgtttaagcttaatgaatgtggagtgaaagtcaacatgttttttgtttaagaataat |
283 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35314240 |
aatgttttatgtttaagcttaatgattgtggagtgaaagtcaacatgttttttgtttaagagtaat |
35314175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University