View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19320_high_22 (Length: 237)
Name: NF19320_high_22
Description: NF19320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19320_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 47118509 - 47118736
Alignment:
| Q |
1 |
aatgaaattttcttacaatttaatttatattaaattannnnnnnaatcacgagatcatatatcacgtcatttaaaacatatcaaattataaatttttagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
47118509 |
aatgaaattttcttacaatttaatttatattaaattatttttt-aatcacgagatcatatatcacgttatttaaaacatatcaaattacaaatttttagt |
47118607 |
T |
 |
| Q |
101 |
tgtaaaatacgatcgaagaacaaaaactgttggatttcaaaatagtgggacaaattatgcaaaatggtaaaaatagagaac--------caatatgagac |
192 |
Q |
| |
|
| |||||||||||||| | || ||||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
47118608 |
tctaaaatacgatcgagggaccaaaactgttggattttaaaatagtgggataaattatgcaaaatggtaaaaatagaaaaccaaaactgcaatatgagac |
47118707 |
T |
 |
| Q |
193 |
tatgagtcgttatcttttttaattacatc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47118708 |
tatgagtcgttatcttttttaattacatc |
47118736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 53 - 101
Target Start/End: Complemental strand, 12619713 - 12619665
Alignment:
| Q |
53 |
gatcatatatcacgtcatttaaaacatatcaaattataaatttttagtt |
101 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
12619713 |
gatcatatatctcgttatttaaaacatatcaaattacaaatttttagtt |
12619665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 25189653 - 25189706
Alignment:
| Q |
123 |
aaaactgttggatttcaaaatagtgggacaaattatgcaaaatggtaaaaatag |
176 |
Q |
| |
|
|||||||||| |||| ||||||| ||||| |||| ||||||||||||||||||| |
|
|
| T |
25189653 |
aaaactgttgaattttaaaatagggggaccaattctgcaaaatggtaaaaatag |
25189706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 101
Target Start/End: Complemental strand, 30017607 - 30017563
Alignment:
| Q |
58 |
tatatcacgtcatttaaaacatatcaaattataaat-ttttagtt |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
30017607 |
tatatcacgtcatttaaaacatatcatattatcaatattttagtt |
30017563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University