View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19320_low_26 (Length: 217)
Name: NF19320_low_26
Description: NF19320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19320_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 47373341 - 47373457
Alignment:
| Q |
1 |
attttctgtgcacaattcaagactctttggattcagaaccaatgaggaacacttctgttgagggggaagataggtggctgttgtggtttcnnnnnnngat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47373341 |
attttctgtgcacaattcaagactctttggactcagaaccaaagaggaacacttctgctgagggggaagataggtggctgttgtggtttctttttttgat |
47373440 |
T |
|
| Q |
101 |
gtgttttgagctatatt |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
47373441 |
gtgttttgagctatatt |
47373457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 90
Target Start/End: Complemental strand, 47385575 - 47385499
Alignment:
| Q |
14 |
aattcaagactctttggattcagaaccaatgaggaacacttctgttgagggggaagataggtggctgttgtggtttc |
90 |
Q |
| |
|
|||||||| ||||||||| ||| | |||| ||||||| ||||||||||| | | |||||||| |||||||||||| |
|
|
| T |
47385575 |
aattcaaggctctttggactcatagccaaagaggaacgtttctgttgaggatgcacataggtggttgttgtggtttc |
47385499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University