View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19320_low_28 (Length: 214)

Name: NF19320_low_28
Description: NF19320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19320_low_28
NF19320_low_28
[»] chr1 (1 HSPs)
chr1 (71-171)||(51590311-51590418)


Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 71 - 171
Target Start/End: Original strand, 51590311 - 51590418
Alignment:
71 taaatgcagatggattagaggtttctgatgttatgatggtttc-------aagagaagcatgttgcaccttttctaattgcttatgacgtacttttcatg 163  Q
    ||||||||||||||||| |||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||| |||||||| |||    
51590311 taaatgcagatggattaaaggtttctgatgttatgatggtttcaactttcaagagaagcatgttgcaccttttctaattgcttatgaggtacttttaatg 51590410  T
164 tgctttat 171  Q
    ||||||||    
51590411 tgctttat 51590418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University