View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19320_low_28 (Length: 214)
Name: NF19320_low_28
Description: NF19320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19320_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 71 - 171
Target Start/End: Original strand, 51590311 - 51590418
Alignment:
| Q |
71 |
taaatgcagatggattagaggtttctgatgttatgatggtttc-------aagagaagcatgttgcaccttttctaattgcttatgacgtacttttcatg |
163 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
51590311 |
taaatgcagatggattaaaggtttctgatgttatgatggtttcaactttcaagagaagcatgttgcaccttttctaattgcttatgaggtacttttaatg |
51590410 |
T |
|
| Q |
164 |
tgctttat |
171 |
Q |
| |
|
|||||||| |
|
|
| T |
51590411 |
tgctttat |
51590418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University