View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19322_low_8 (Length: 314)
Name: NF19322_low_8
Description: NF19322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19322_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 45 - 282
Target Start/End: Original strand, 24151353 - 24151594
Alignment:
| Q |
45 |
ttggtatgtggaaccactcgtagtcactgaaaaatcacaaagcaccgttgctacttgtactgaaaaagataaagcgttatatgggtaaatga---cactc |
141 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
24151353 |
ttggtatg-ggaaccactcgtagtcactgaaaaatcacaaagcaccgttgctacttgtattgaaaaagataaagcgttatatgggtaaatgcgggctctc |
24151451 |
T |
 |
| Q |
142 |
ttatttaaatcagtggaagttgactgtccttgacggttttggaaaggaaaaccttattaatcacattacactcggtaaatcaaaaggcatggttatcaat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
24151452 |
ttatttaaatcagtggaagttgactgtccttgacggttttgggaaggaaaaccttattaatcacattacactcagtaaatcaaaatgcatggttatcaat |
24151551 |
T |
 |
| Q |
242 |
tactt--tgggaaatgctaacatgtattctactccctccgtcc |
282 |
Q |
| |
|
|| || | ||||||||||||||||||||||||||||||||| |
|
|
| T |
24151552 |
taattaatccgaaatgctaacatgtattctactccctccgtcc |
24151594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University