View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19323_high_2 (Length: 256)
Name: NF19323_high_2
Description: NF19323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19323_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 23 - 242
Target Start/End: Original strand, 7480867 - 7481083
Alignment:
| Q |
23 |
acatcaactttattcttctactatctatctttgtctttggtgtgattgtttggaatttcgtttgcacatcaaaaat-aattgttctaggctgaatcttta |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
7480867 |
acatcaactttattcttctactatctatctttctctttggtgtgattgtttggaatttcgtttgcacataaaaaaagaattgttctaggctgaatcttta |
7480966 |
T |
|
| Q |
122 |
tctgccaagttatttaatttgattgccatcattatttaaattttttaacaaaatgttatgttataaagtttctgtctaatattaattgtgtatgagggac |
221 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| || | | |||||| |
|
|
| T |
7480967 |
tctgccaagtcatttaatttgattgctattattatttaaattttttaacaaaatgttatgttataaagtttctgtctaatatt----gtttttaagggac |
7481062 |
T |
|
| Q |
222 |
ctgtccaatattcttatttat |
242 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7481063 |
ctgtccaatattcttatttat |
7481083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University