View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19323_low_4 (Length: 263)
Name: NF19323_low_4
Description: NF19323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19323_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 6909628 - 6909390
Alignment:
| Q |
1 |
attatcattcaacttttaaagttttgaatgannnnnnnnngtcgtgtttaaaatatttcttcacataaaaataatatgaatctttcaaacgtcaaaagct |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
6909628 |
attatcattcaacttttaaatttttgaatgaattttttttgtcgtgtttaaaatatttcttcacataaaaataatatgaatcttccaaacatcaaaagct |
6909529 |
T |
|
| Q |
101 |
ctaaagaaaagcaacaaaatttggacatagaaattaatttttgaggtcagattttgtgcgggaactttttatagtgttctaaaaatgtctgcaaaattca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6909528 |
ctaaagaaaagcaacaaaatttggacatagaaactaatttttgaggtcagattttgtgcgggaactttttatagtgttctaaaaatgtctgcaaaattca |
6909429 |
T |
|
| Q |
201 |
ttcaaaagataaagttgatctaacatcaaagactcccct |
239 |
Q |
| |
|
|||||||| | ||||||||||||||||||| |||||||| |
|
|
| T |
6909428 |
ttcaaaagtttaagttgatctaacatcaaatactcccct |
6909390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University