View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19324_low_7 (Length: 221)

Name: NF19324_low_7
Description: NF19324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19324_low_7
NF19324_low_7
[»] chr7 (1 HSPs)
chr7 (19-205)||(33831308-33831502)


Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 33831308 - 33831502
Alignment:
19 attatcgcacgtgatataaccccactatgccacgtatctatataatattgatattaatgttcttgat---atggtcgacgttactaacgttaattatgta 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||   ||||||||||||||||||||||||||||||    
33831308 attatcgcacgtgatataaccccactatgccacgtatctatataatat-gatattaatgttcttgatgatatggtcgacgttactaacgttaattatgta 33831406  T
116 cgtgt------gatcaacataaataacacgtacaacatacaacattatcatctgtccagaatcagttttaaattgtcgtttgcattgtaagtttgt 205  Q
    |||||      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33831407 cgtgtgtgtgtgatcaacataaataacacgtacaacatacaacattatcatctgtccagaatcagttttaaattgtcgtttgcattgtaagtttgt 33831502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University