View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19325_high_5 (Length: 231)
Name: NF19325_high_5
Description: NF19325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19325_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 10 - 213
Target Start/End: Complemental strand, 33711547 - 33711344
Alignment:
| Q |
10 |
attattctttgtttgatattgtttcttgaagttattgtataacttttgtttcttttcttctttgacttgagtgtttaattaatttaaatttggtaaataa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33711547 |
attattctttgtttgatattgtttcttgaagttattgtataacttttgtttcttttcttctttgacttgagtgtttaattaatttaaatttggtaaataa |
33711448 |
T |
 |
| Q |
110 |
tnnnnnnngaatgatcaaatctattagcaaccttgactagtaatgaatgcatatttgttaaaatgtattgaannnnnnnnctttctgaatttacatgctg |
209 |
Q |
| |
|
| |||||||| ||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33711447 |
taaaaaaagaatgatctaatctattagcaaccttgagtagtaatgaatgcatattagttaaaatgtattgaattttttttctttctgaatttacatgctg |
33711348 |
T |
 |
| Q |
210 |
tagt |
213 |
Q |
| |
|
|||| |
|
|
| T |
33711347 |
tagt |
33711344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University