View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19325_high_6 (Length: 229)
Name: NF19325_high_6
Description: NF19325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19325_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 55 - 175
Target Start/End: Complemental strand, 16703522 - 16703401
Alignment:
| Q |
55 |
ataactcataattaccactatcatcaacatactctgatctcaaatactacaagcagggaaaaaatatattcttgatgattattta-ttttattattccta |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16703522 |
ataactcataattaccactatcatcaacatactctgatctcaaatactacaagcagggaaaaaatatattcttgatgattatttatttttattattccta |
16703423 |
T |
 |
| Q |
154 |
aattatctttcaatgtagatca |
175 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
16703422 |
aattatctttcaatatagatca |
16703401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 165 - 219
Target Start/End: Complemental strand, 16703386 - 16703333
Alignment:
| Q |
165 |
aatgtagatcatattttagaataacttcttttattctcttaaaacaagtgttcat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16703386 |
aatgtagatcatattttagaataacttc-tttattctcttaaaacaagtgttcat |
16703333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University