View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19326_low_13 (Length: 227)
Name: NF19326_low_13
Description: NF19326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19326_low_13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 40047955 - 40048175
Alignment:
| Q |
7 |
tttgtcttgtcagctttcggtgctattgcttccgcaacaggagcagcagcaggtgccttagtcccaaagaaatcaggaggaagcaaaaccttatccaaac |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40047955 |
tttgtcttatcagctttcggtgctattgcttccgcaacaggagcagcagcaggtgccttagtcccaaagaaatcaagaggaagcaaaaccttatccaaac |
40048054 |
T |
|
| Q |
107 |
gatatatagcaagcttgttatcttgatagactacaccagtaacactagcattaaccacaccagttgaaagactaacactggtaccaaacgattcgatgtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40048055 |
gatatatagcaagcttgttatcttgatagactacaccagtaacactagcattaaccacaccagttgaaagactaacactggtaccaaacgattcgatgtt |
40048154 |
T |
|
| Q |
207 |
caatggaagctttaaagggtc |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40048155 |
caatggaagctttaaagggtc |
40048175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University