View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19326_low_9 (Length: 255)
Name: NF19326_low_9
Description: NF19326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19326_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 9 - 239
Target Start/End: Original strand, 40224069 - 40224296
Alignment:
| Q |
9 |
gattattctgataacaaatatacaagcttagcactctaaaatttgcatgccaattcttccnnnnnnnnnnnnnnccactccgaaaccaaaacactagatc |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
40224069 |
gattcttctgataacaaatatacaagcttagcactctaaaatttgcatgccaattcttccaaaaaaaaataa--ccactccaaaaccaaaacactagatc |
40224166 |
T |
 |
| Q |
109 |
caagcatagccgaaattaaggattcactatttattnnnnnnntagagaatatttcaaatcataaaacaaagtgttgggcaaattaccagaaaaattatct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40224167 |
caagcatagccgaaattaaggattcactatttattaaaaaa-tagagaatatttcaaatcataaaacaaagtgttgggcaaattaccagaaaaattatct |
40224265 |
T |
 |
| Q |
209 |
ggtacgaggatgtaactatcttggtctgagc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40224266 |
ggtacgaggatgtaactatcttggtctgagc |
40224296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University