View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19327_low_15 (Length: 202)
Name: NF19327_low_15
Description: NF19327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19327_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 1340024 - 1339846
Alignment:
| Q |
15 |
caaaggcttgtcgaagaacaaattgacaaaaagattgttttgtcaatgagagctatttatcagtcaaaaataggtcttggtctaatggacataggtatgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1340024 |
caaaggcttgtcgaagaacaaattgacaaaaagattgttttgtcaatgagagctatttatcagtcaaaaataggtcttggtctaatggacataggtatgt |
1339925 |
T |
 |
| Q |
115 |
gggttgtttatttctttctttcttttaatagttgaaagaaattgtaggctaaatgtatatttgacaggattgatgatgt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1339924 |
gggttgtttatttctttctttcttttaatagttgaaagaaattgtaggctaaatgtatatttgacaggattgatgatgt |
1339846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University